View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_high_16 (Length: 278)
Name: NF13196_high_16
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_high_16 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 11 - 244
Target Start/End: Complemental strand, 29510630 - 29510397
Alignment:
| Q |
11 |
ttatactgtggtaaaaggcagacatggccgtaattgcggttgtgatgccattgaaaaggcctaaaactgttatactgtggccacaattgcagtcgcagac |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29510630 |
ttatactgtggtaaaaggcagacgtggccgtaattgcggttgtgatgccattgaaaaggcctaaaactgttatactgtggccacaattgcagttgcagac |
29510531 |
T |
 |
| Q |
111 |
cgcaatttacaaccattgttttcatagtcaatggtgtatgccagtttggcttcaatatgattgtagttttgctgaccttttgattataccctactgattg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29510530 |
cgcaatttacaaccattgttttcatagtcaatggtgtatgccagtttggcttcaatatgattgtagtttttctgaccttttgattataccctactgattg |
29510431 |
T |
 |
| Q |
211 |
atatcaaatatttaataaatagaaaaaacatgaa |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
29510430 |
atatcaaatatttaataaatagaaaaaacatgaa |
29510397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 71 - 119
Target Start/End: Complemental strand, 16950873 - 16950825
Alignment:
| Q |
71 |
ctaaaactgttatactgtggccacaattgcagtcgcagaccgcaattta |
119 |
Q |
| |
|
|||||||||||||| || ||||||||||||||| || |||| ||||||| |
|
|
| T |
16950873 |
ctaaaactgttatattgcggccacaattgcagttgcggaccacaattta |
16950825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University