View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_high_6 (Length: 375)
Name: NF13196_high_6
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_high_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 254; Significance: 1e-141; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 254; E-Value: 1e-141
Query Start/End: Original strand, 2 - 280
Target Start/End: Complemental strand, 2161065 - 2160791
Alignment:
| Q |
2 |
ctcgtttgtgcagcatcagggaaacgatagaaacatgtaaagtgtcatccaggtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccac |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2161065 |
ctcgtttgtgcagcatcagggaaacgatagaaacatgtaaagtgtcatccaggtcaataaaatttgatgagtgccattgtagcgaccattcaaaacccac |
2160966 |
T |
|
| Q |
102 |
caattcttctcattctgtcaagtgcaaatgctgcatcgaatccgaatcccaaactcaaccttatctcctcaattttgctggcatataccaaagtctcaca |
201 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2160965 |
cgattcttctcattctgtcaagtgcaaatgctgcatcgaatccgaatcccaaactcaaccttatctcctcaattttgctggcatataccaaagtctcaca |
2160866 |
T |
|
| Q |
202 |
cacaaaaatactcccagttggtacgtccaaatgaggtcttgggctacccacccaaatccggaagctccagctggaaaaa |
280 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
2160865 |
cacaaaaatactcccagttggtacgtccaaatgaggtcttgggtt----acccaaatccggaagctccagctggaaaaa |
2160791 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 275 - 365
Target Start/End: Complemental strand, 2160748 - 2160658
Alignment:
| Q |
275 |
gaaaaatactcaccattctgattttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctctcattattgtgcctttg |
365 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
2160748 |
gaaaaatactcaccattctggttttgtaatgccctcaatgaatttcttatgttgctatatgggttaggtgtctatcattattgtgcctttg |
2160658 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University