View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_low_12 (Length: 300)
Name: NF13196_low_12
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 176; Significance: 8e-95; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 71 - 283
Target Start/End: Complemental strand, 29510303 - 29510091
Alignment:
| Q |
71 |
ccttctgacaactagtttggataaacatttcaatgaacacttggacaaattagtnnnnnnntagttgaaattataatgaatataagaataaggatgaata |
170 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29510303 |
ccttctgacaacaagtttggataaacatttcaatgaacacttggacaaattagtaaaaaaatagttgaaatcataatgaatataagaataaggatgaata |
29510204 |
T |
 |
| Q |
171 |
tgacattttgttaaactttctgcaaaataattgtcttgtgagtgatgctaaaaatacatgttcattgtggctatacgcacttcttgaattcgttggcttg |
270 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
29510203 |
tgacattttgttaaactttctgcaaaataattgtcttgtgagtgatgctaaaaatacatgttcattgtggctatacgcacttcttgaatttgttggtttg |
29510104 |
T |
 |
| Q |
271 |
atcagttaaaatt |
283 |
Q |
| |
|
||||||||||||| |
|
|
| T |
29510103 |
atcagttaaaatt |
29510091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 29510360 - 29510315
Alignment:
| Q |
1 |
tataagaggagagatagttgaaggtaaaagactgataaacattggg |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29510360 |
tataagaggagagatagttgaaggtaaaagactgataaacattggg |
29510315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University