View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_low_17 (Length: 268)
Name: NF13196_low_17
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 30 - 246
Target Start/End: Original strand, 5897904 - 5898120
Alignment:
| Q |
30 |
cctgaaaatctctcattggcatggaattcatgcttcattaattctatatatgaggcagccacgttatatggataagtacaatttagttcttttccttgat |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
5897904 |
cctgaaaatctctcattggcatggaattcatgcttcattaattctatatatgaggcagccacgttatatggatgagtacaatttagttcttttccttgat |
5898003 |
T |
 |
| Q |
130 |
tcttgatcagcaactgaacacgtatagttctcttcttcttcacgtttgaattggattgaacaataaccaagcaacgaaatttcatagattttttgtagat |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5898004 |
tcttgatcagcaactgaacacgtatagttctcttcttcttcacgtttgaattggattgaccaataaccaagcaacgaaatttcatagattttttgtagat |
5898103 |
T |
 |
| Q |
230 |
agtaaaagtttgtatca |
246 |
Q |
| |
|
||| ||||||||||||| |
|
|
| T |
5898104 |
agttaaagtttgtatca |
5898120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University