View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13196_low_9 (Length: 324)
Name: NF13196_low_9
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13196_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 97 - 135
Target Start/End: Original strand, 11378852 - 11378890
Alignment:
| Q |
97 |
tttatagtcacaaaacttagaaagcaatccaccaatatg |
135 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11378852 |
tttatagtcacaaaacttagaaagcaatccaccaatatg |
11378890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University