View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13196_low_9 (Length: 324)

Name: NF13196_low_9
Description: NF13196
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13196_low_9
NF13196_low_9
[»] chr4 (1 HSPs)
chr4 (97-135)||(11378852-11378890)


Alignment Details
Target: chr4 (Bit Score: 39; Significance: 0.0000000000005; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 39; E-Value: 0.0000000000005
Query Start/End: Original strand, 97 - 135
Target Start/End: Original strand, 11378852 - 11378890
Alignment:
97 tttatagtcacaaaacttagaaagcaatccaccaatatg 135  Q
    |||||||||||||||||||||||||||||||||||||||    
11378852 tttatagtcacaaaacttagaaagcaatccaccaatatg 11378890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University