View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13199_low_12 (Length: 379)
Name: NF13199_low_12
Description: NF13199
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13199_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 336; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 336; E-Value: 0
Query Start/End: Original strand, 12 - 363
Target Start/End: Original strand, 39166825 - 39167176
Alignment:
| Q |
12 |
atgaagcagttaaagaacctgttttgggtcacatttttgcctcttaaatccaaaccaaactcactcacaaacaatggccatccttggtctaacaagaacc |
111 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166825 |
atgaagcagttaaagaacctgttttggttcatatttttgcctcttaaatccaaaccaaactcactcacaaacaatggccatccttggtctaacaagaacc |
39166924 |
T |
 |
| Q |
112 |
ctgactttctcacaaagctacttgtaacttgtccacacacttggtttggattctctaatgtccatgcttgactgtcactaaagctataccaatgctcctc |
211 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39166925 |
ctgaatttctcacaaagctacttgtaacttgtccacacacttggtttggattctctaatgtccatgcttgactgtcactaaagctataccaatgctcctc |
39167024 |
T |
 |
| Q |
212 |
aaatactagtttcccattaaaggtaagcttcactggctggtttgtaatgaatgataagtcagtgtcaaaatttaagccagacagaatgacaagaacattc |
311 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167025 |
aaatactagtttcccattaaaggtaagcttcactggctggtttgtaatgaatgataagtcagtgtcaaaatttaagccagacagaatgacaagaacattc |
39167124 |
T |
 |
| Q |
312 |
ggattcgcagcatgcacgacttctgctccttttggcatgtacctataattca |
363 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167125 |
gaattcgcagcatgcacgacttctgctccttttggcatgtacctataattca |
39167176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 57 - 100
Target Start/End: Original strand, 37313763 - 37313806
Alignment:
| Q |
57 |
aaatccaaaccaaactcactcacaaacaatggccatccttggtc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
37313763 |
aaatccacaccaaactcactcacaaacaatggccatccttggtc |
37313806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 60 - 107
Target Start/End: Complemental strand, 37407161 - 37407114
Alignment:
| Q |
60 |
tccaaaccaaactcactcacaaacaatggccatccttggtctaacaag |
107 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
37407161 |
tccacaccaaactcactgacaaacaatggccatccttggtctaccaag |
37407114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University