View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_high_18 (Length: 372)
Name: NF1319_high_18
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_high_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-103; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-103
Query Start/End: Original strand, 132 - 341
Target Start/End: Complemental strand, 11646453 - 11646246
Alignment:
| Q |
132 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagacgatgtttattcaaattcagtgcataccacagagacttgagagaactctgag |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||| ||| |
|
|
| T |
11646453 |
tgcaagttattcaacttaacttgttatttaaggaactcaaaaaagagactatgtttattcaaattcagtgcatactacagagacttgagagaact--gag |
11646356 |
T |
 |
| Q |
232 |
attgcaaagagctataaataaaactttcattcctcattttgccaataatcaaacaaaagggacaaatgcctatagatagtagaatcaaaataatgtcata |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11646355 |
attgcaaagagctataaataaaactttcattcctcattttgccaataatcaaacaaaagggacaaatgcctatagatagtagaatcaaaataatgtcata |
11646256 |
T |
 |
| Q |
332 |
tgtttatggt |
341 |
Q |
| |
|
|||||||||| |
|
|
| T |
11646255 |
tgtttatggt |
11646246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 8e-40
Query Start/End: Original strand, 274 - 365
Target Start/End: Original strand, 11591743 - 11591834
Alignment:
| Q |
274 |
caataatcaaacaaaagggacaaatgcctatagatagtagaatcaaaataatgtcatatgtttatggtgacttcgataaaatgatattgttg |
365 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
11591743 |
caataatcaaacaaaaaggacaaatgcctatagatagtagaatcaaaataatgtcatatgtttatggtgacttcgataaaatgattttgttg |
11591834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University