View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_high_23 (Length: 357)
Name: NF1319_high_23
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_high_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 6e-59; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 170 - 330
Target Start/End: Original strand, 32825472 - 32825630
Alignment:
| Q |
170 |
cctaacttgaccctacaaattccaactttggaagattgtgagggtttcttcttattttgattttaaaaacaannnnnnnnnnnngttagtttcgttgctt |
269 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32825472 |
cctaacttgaccctacaaattccaaccttggaagattgtgagggtttcttcttattttgattttaaaaacaatttttttttt--gttagtttcgttgctt |
32825569 |
T |
|
| Q |
270 |
gtacatttgatggtggagttggtgtgttgtagtttgtttgagaaaatgagaggagtaggtg |
330 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32825570 |
gtacatttgatggtggagttggtgtgttgtagtttgtttgagaaaatgagaggagtaggtg |
32825630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 12 - 95
Target Start/End: Original strand, 32825314 - 32825397
Alignment:
| Q |
12 |
agagacaaatattgtagttggtgattattttgttgaagatttttctttatagggatgattgaagaagatgagttaataaagaga |
95 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32825314 |
agagacaaatattgtagttggtgatgattttgttgaagatttttctttatagggatgattgaagaagatgagttaataaagaga |
32825397 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University