View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_high_24 (Length: 356)
Name: NF1319_high_24
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_high_24 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 14 - 329
Target Start/End: Original strand, 38710337 - 38710651
Alignment:
| Q |
14 |
agaagaggaacatgctttgaaaatcacatatgatggaagataaaggggtgtggcagaggaagacaattatccaacaacgagataaagcaatttcaaagaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38710337 |
agaagaggaacatgctttgaaaatcacatatgatggaagataaaggggtgtggcagaggaagacaattatccaacaacgagataaagcaatttcaaagaa |
38710436 |
T |
|
| Q |
114 |
gaaggcatggttcttggacttaggttgtagtaaccatatgtgtggtaataaaaaatggttctttgaaggagagagagtaatcttatatgaaatattggag |
213 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
38710437 |
gaaggcatagttcttggacttaggttgtagtaaccatatgtgtggtaataaaaaatggttctttgaaggagagagagtaatcttataagaaatattggag |
38710536 |
T |
|
| Q |
214 |
gcattatacaactcattcctagtgtgtagtacatctcatagttgaagaaacaatctatagggcaattgccggagaaggggctgactataatatttcaaca |
313 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38710537 |
gcattatacaactcattcctagtgtgtagtacatctcatagttgaag-aacaatctatagggcaattgcaggagaaggggctgactataatatttcaaca |
38710635 |
T |
|
| Q |
314 |
tgataaatgcaaagtg |
329 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
38710636 |
tgataaatgcaaagtg |
38710651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University