View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_high_31 (Length: 308)
Name: NF1319_high_31
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_high_31 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 235; Significance: 1e-130; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 235; E-Value: 1e-130
Query Start/End: Original strand, 28 - 308
Target Start/End: Original strand, 31805056 - 31805336
Alignment:
| Q |
28 |
caatcttctcacagggtacccaaactgggttccttccgtcacagtttccttgnnnnnnnnnnnnnnctcatgtcaatgaaaggtggcggtggcggtgggt |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
31805056 |
caatcttctcacagggtacccaaactgggttccttccgtcacagtttccttgaaaaaaaggaaaaactcatgtcaatgaaaggtggcggtggcggtgggt |
31805155 |
T |
 |
| Q |
128 |
attcacagatcggcatccctttaccggaatccgacgatgatgatgactacattcaacgacgacggtggtgttcgtttcgaggattctcagatgggatcgt |
227 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31805156 |
attcacaaatcggcatccctttaccggaatccgacgatgatgatgactacattcaacgacgacggtggtgttcgtttcgaggattctcagatgggatcgt |
31805255 |
T |
 |
| Q |
228 |
agagttttggaagaaatcaaagcgtgtggcgggtagagcatgggagatgggtgtgtctgatccaaggaagtttgtgttttc |
308 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31805256 |
agagttttggaagaaatcaaagcgtgtggcgggtagagcatgggagatgggtgtgtctgatccaaggaagtttgtgttttc |
31805336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University