View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_high_38 (Length: 254)
Name: NF1319_high_38
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 101; Significance: 4e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 103 - 226
Target Start/End: Complemental strand, 44194333 - 44194209
Alignment:
| Q |
103 |
agggcaagaatttttgccagaatgagttagcattgctactgactcttggatcactatgattcctctaaacgaccacc-ttgaatctagtaaaattctgca |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
44194333 |
agggcaagaatttttgccagaatgagttagcattgttattgactcttggatcactatgattcatctaaacaaccacctttgaatctagtaaaattctgca |
44194234 |
T |
|
| Q |
202 |
tgttaaaagcaaaagatagcgtagt |
226 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44194233 |
tgttaaaagcaaaagatagcgtagt |
44194209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 50 - 78
Target Start/End: Complemental strand, 44194388 - 44194360
Alignment:
| Q |
50 |
tcagatattagaagtccaataaaaataat |
78 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44194388 |
tcagatattagaagtccaataaaaataat |
44194360 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University