View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_15 (Length: 427)
Name: NF1319_low_15
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 165 - 398
Target Start/End: Complemental strand, 5304364 - 5304131
Alignment:
| Q |
165 |
ctcaaatttgaaggagttttagttgagtttagaatgctaaaattttgtcactttgatgagttttactttgctcgtttttatcttgtatttcaattgtaag |
264 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5304364 |
ctcaaatttgaaggagttttagttgagtttagaatgctaaaattttgtcactttgatgagttttactttgctcgtttttatcttgtatttcaattgtaag |
5304265 |
T |
 |
| Q |
265 |
tgaggatagtaggacaaccttgtcttgttatgaaggatcaaatgagaaagtgttttgggatttaggagggaccatattttgcacagtttttggtttgttg |
364 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
5304264 |
tgaggatagtaggacaaccttgtcttgttatgaaggatcaaatgagaaagtgttttgggatttaggagggaccatattttgcacagtttctggtttgttg |
5304165 |
T |
 |
| Q |
365 |
ttgttcattgaatccatttatgaatggatatgtt |
398 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
5304164 |
ttgttcattgaatccatttatgaatgtatatgtt |
5304131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 34; Significance: 0.0000000006; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 110 - 236
Target Start/End: Original strand, 16292528 - 16292656
Alignment:
| Q |
110 |
tgtgagtgcatctgccgcaactggaaaagaagaaaaatcgatgatagagattatgctcaaatttgaaggagttttagttgagtttagaatgctaaaattt |
209 |
Q |
| |
|
|||||||||||| | | |||| |||||||||||||| | | || | | |||||||||||||||||||| |||||||| ||||||||||| |||| |
|
|
| T |
16292528 |
tgtgagtgcatccgatgtaactagaaaagaagaaaaagcaaagacataaattatgctcaaatttgaagggtcattagttgaacatagaatgctaagattt |
16292627 |
T |
 |
| Q |
210 |
tg--tcactttgatgagttttactttgct |
236 |
Q |
| |
|
|| ||||||||||||||| || |||||| |
|
|
| T |
16292628 |
tgtatcactttgatgagttctattttgct |
16292656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University