View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_17 (Length: 405)
Name: NF1319_low_17
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 243; Significance: 1e-134; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 243; E-Value: 1e-134
Query Start/End: Original strand, 30 - 288
Target Start/End: Complemental strand, 33399402 - 33399144
Alignment:
| Q |
30 |
acctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgattcacagg |
129 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
33399402 |
acctacaccggcccctcaagcagcaccaccttcaaatgcaccatggaccgctccccgccggtccctgctgcaaaagtagctattcaaaacgattcacagg |
33399303 |
T |
|
| Q |
130 |
aatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagtgactaaaatcattaattatttattttcttta |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
33399302 |
aatctgataactgtttgagattggattagttcatgtgtcatgtttcaaagtggggctattttttctagttactaaaatcattaattatttattttcttta |
33399203 |
T |
|
| Q |
230 |
tgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgat |
288 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33399202 |
tgttggtgaatttatttacacacataaataaaaagaatcacacgtttcctagtgatgat |
33399144 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 81; E-Value: 5e-38
Query Start/End: Original strand, 30 - 154
Target Start/End: Complemental strand, 33395518 - 33395394
Alignment:
| Q |
30 |
acctacaccggcccctcaagcagcaccgccttcaaatgcaccatggaccgctccccgacggtccctgctgcaaaagaagctattcaaaacgattcacagg |
129 |
Q |
| |
|
|||||||||| ||||| ||| ||||||||||||||||||||||||||||||| |||| |||||||| |||| ||||||||||||||||| ||||||||| |
|
|
| T |
33395518 |
acctacaccgtcccctgaagtagcaccgccttcaaatgcaccatggaccgctgcccgccggtccctactgccaaagaagctattcaaaatgattcacaga |
33395419 |
T |
|
| Q |
130 |
aatctgataactgtttgagattgga |
154 |
Q |
| |
|
||| ||||| ||||||||||||||| |
|
|
| T |
33395418 |
aatttgatagctgtttgagattgga |
33395394 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 37 - 75
Target Start/End: Complemental strand, 33399587 - 33399549
Alignment:
| Q |
37 |
ccggcccctcaagcagcaccgccttcaaatgcaccatgg |
75 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33399587 |
ccggcccctgaagcagcaccgccttcaaatgcaccatgg |
33399549 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 33395611 - 33395566
Alignment:
| Q |
30 |
acctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
75 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||||||||||||||| |
|
|
| T |
33395611 |
acctacaccggcccatgaagcagcaccgtcttcaaatgcaccatgg |
33395566 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 30 - 75
Target Start/End: Complemental strand, 33399495 - 33399450
Alignment:
| Q |
30 |
acctacaccggcccctcaagcagcaccgccttcaaatgcaccatgg |
75 |
Q |
| |
|
||||||||| |||||| |||| ||||| |||||||||||||||||| |
|
|
| T |
33399495 |
acctacaccagcccctgaagccgcacctccttcaaatgcaccatgg |
33399450 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University