View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_32 (Length: 346)
Name: NF1319_low_32
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 13 - 317
Target Start/End: Original strand, 51466204 - 51466507
Alignment:
| Q |
13 |
aatattcaactattcattctctttctctaatactcttctttttcttcaagtcttcattggagcttcaacaacgtacaatagtgttcgatttcaatcagaa |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51466204 |
aatattcaactattcattctctttctctactactcttctttttcttcaagtcttcattggagcttcaacaacgtacaatagtgttcgatttcaatcagaa |
51466303 |
T |
|
| Q |
113 |
catgnnnnnnnnnttggggtagaacctgatgtgactataacaacaccatgcctcacactaggttttccccaggcttgagaagctgcaaaaatacagtaan |
212 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51466304 |
catgaaaaaaaaattggggtagaacctgatgtgactataacaacaccatgcctcacactaggttttccccaggcttgagaagctgcaaaaatacagtaa- |
51466402 |
T |
|
| Q |
213 |
nnnnnnnatgttagaatggatcattatttggcataccattaaaaataagtggtaaaggtcaaggttaagtgttactttttatatcgttttttatcggggc |
312 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
51466403 |
attttttatgttagaatgaatcattatttggcataccattaaaaataagtggtaaaggtcaaggttaagttttactttttatatctttttttatcggggc |
51466502 |
T |
|
| Q |
313 |
ataga |
317 |
Q |
| |
|
||||| |
|
|
| T |
51466503 |
ataga |
51466507 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University