View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_33 (Length: 337)
Name: NF1319_low_33
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_33 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 103 - 260
Target Start/End: Complemental strand, 26454750 - 26454590
Alignment:
| Q |
103 |
agtattgacataatgataattgatggtgaagaagaa---ataatccaaaatgatgaaaacatatgaagacaagagatgtggtcgtgatgataatcaatca |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454750 |
agtattgacataatgataattgatggtgaagaagaagaaataatccaaaatgatgacaacatatgaagacaagagatgtggtcgtgatgataatcaatca |
26454651 |
T |
 |
| Q |
200 |
tagtattttttagcataatttaggagacattttagagtgtttctagcaagttataattcat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26454650 |
tagtattttttagcataatttaggagacattttagagtgtttctagcaagttataattcat |
26454590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University