View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_35 (Length: 336)
Name: NF1319_low_35
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_35 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 324; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 324; E-Value: 0
Query Start/End: Original strand, 1 - 336
Target Start/End: Complemental strand, 21269054 - 21268719
Alignment:
| Q |
1 |
tgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctctgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21269054 |
tgagttcaactttcttcttaatcttctcagcaagattgtctctcagttttgtggggtccacatttccggtgacggttacttttccggtttcactctctgc |
21268955 |
T |
 |
| Q |
101 |
tttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268954 |
tttcaccgtatcaacaccttaaaaacagaaacatggttgttcaattttaacgattgaaaaatgaattgaagaacaatgatgaaaacccagatcggaaaaa |
21268855 |
T |
 |
| Q |
201 |
atgtgtagaaacagaggagtgtgagaaaaatgatacctttgatactgttaaggtgtttggttactttgttagcgcaaccttcgcaatgcatatagacttt |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268854 |
atgtgtagaaacagaggagtgtgagaaaaatgatacctttgatgccgttaaggtgtttggtgactttgttagcgcaaccttcgcaatgcatatagacttt |
21268755 |
T |
 |
| Q |
301 |
caaaaccgttgcgttgtttttgcctttgttgttgtt |
336 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
21268754 |
caaaaccgttgcgttgtttttgcctttgttgttgtt |
21268719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University