View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_39 (Length: 319)
Name: NF1319_low_39
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 95 - 284
Target Start/End: Complemental strand, 38823399 - 38823217
Alignment:
| Q |
95 |
attctgaagcccacttttaaataattggtatgatttgtttctttgaataagattttgtgaactgacatgtattt-gttcacttattgagttaattttgaa |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
38823399 |
attctgaagcccacttttaaataattggtatg------------gaataagattttgtgaactgacatgtattttgttcacttattgagttaattttgaa |
38823312 |
T |
|
| Q |
194 |
caacgatgacatcttctgtcttgtagcttgatgc----ttaggtaacagttgaccatgttatgtcaaacatgtcttgctttgtatggaaaaacag |
284 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38823311 |
caacgatgacatcttctgtcttgtagtttgatgcttaattaggtaacagttgaccatgttatgtcaaacatgtcttgctttgtatggaaaaacag |
38823217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 102 - 173
Target Start/End: Original strand, 38815845 - 38815916
Alignment:
| Q |
102 |
agcccacttttaaataattggtatgatttgtttctttgaataagattttgtgaactgacatgtatttgttca |
173 |
Q |
| |
|
|||| |||||| |||||||||||| ||||||| ||||||| |||||||||| | |||||||||||| |||| |
|
|
| T |
38815845 |
agcctactttttaataattggtattatttgttcctttgaacaagattttgtaacatgacatgtatttattca |
38815916 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University