View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_40 (Length: 319)
Name: NF1319_low_40
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_40 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 98 - 230
Target Start/End: Original strand, 41807030 - 41807162
Alignment:
| Q |
98 |
catctagctcaaaaatgtgattgagatttacaaagcttaagtcattttttagtaaaactcattgttcaatctgttcagctatgaaaatgaataacagttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41807030 |
catctagctcaaaaatgtgattgagatttacaaagcttaagccattttttagtaaaactcattgttcaatctgttcagctatgaaaatgaataacagttg |
41807129 |
T |
|
| Q |
198 |
catagaaagcttagctgttcctttactgacaca |
230 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
41807130 |
catagaaagattagctgttcctttactgacaca |
41807162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 159 - 206
Target Start/End: Complemental strand, 42031616 - 42031569
Alignment:
| Q |
159 |
ttgttcaatctgttcagctatgaaaatgaataacagttgcatagaaag |
206 |
Q |
| |
|
||||||||| ||||||||||||||| ||||||||||||| |||||||| |
|
|
| T |
42031616 |
ttgttcaatatgttcagctatgaaactgaataacagttgaatagaaag |
42031569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University