View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_41 (Length: 317)
Name: NF1319_low_41
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_41 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 2467743 - 2468028
Alignment:
| Q |
1 |
agcacttttcatctttcaccacctcacttatatcctcttccattttcccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcac |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467743 |
agcactttttatctttcaccacctcacttatatcctcttccatttttccccctcctactcctcgctgcaatctcaaattaccaccacgctttcaattcac |
2467842 |
T |
|
| Q |
101 |
caacatttttcgggctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggat |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467843 |
caacatttttcggtctacaacggtaatttcctgaacctatcttcaacttcatttcattcaattcaatgcctcaaatttattttcattttcgtatagggat |
2467942 |
T |
|
| Q |
201 |
tcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
286 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2467943 |
tcgttcgtgcttccgaggatgactctgttgccgaaaattccgattctcaatgccaattggcaacacagaatgtgtcttctgatgat |
2468028 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University