View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_45 (Length: 295)
Name: NF1319_low_45
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 114; Significance: 8e-58; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 140 - 257
Target Start/End: Complemental strand, 10045579 - 10045462
Alignment:
| Q |
140 |
ttagaagttatttatagcgagtgaaggagggaaatgggaaagaccatgttgtacacgagtacagcgtgtcgttttaatacttcactttattggttagaca |
239 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10045579 |
ttagaagttatttatagcgagtgagggagggaaatgggaaagaccatgttgtacacgagtacagcgtgtcgttttaatacttcactttattggttagaca |
10045480 |
T |
|
| Q |
240 |
attttattttgacaaatt |
257 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
10045479 |
attttattttgacaaatt |
10045462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 247 - 280
Target Start/End: Complemental strand, 10045438 - 10045405
Alignment:
| Q |
247 |
tttgacaaattatttttacttagacaaacttttt |
280 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10045438 |
tttgacaaattatttttacttagacaaacttttt |
10045405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University