View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_46 (Length: 289)
Name: NF1319_low_46
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_46 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 2e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 2e-86
Query Start/End: Original strand, 52 - 221
Target Start/End: Original strand, 44618200 - 44618369
Alignment:
| Q |
52 |
aatattggctagttaagttaatggatagttcgattcagcctattgccatcaccctacttgtgattcatttacttttctttctcttctccaattttttctt |
151 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44618200 |
aatattggctagttaagttaatggatagttcgattcagcctattgccatcaccctacttgtgattcatttacttttctttctcttctccaatttttactt |
44618299 |
T |
|
| Q |
152 |
acgaagctagaaagaagaaatatattaactgaaccaccttggcctccccaaaattagagtgtcaggaaag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44618300 |
acgaagctagaaagaagaaatatattaactgaaccacattggcctccccaaaattagagtgtcaggaaag |
44618369 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University