View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_51 (Length: 274)
Name: NF1319_low_51
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_51 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 174 - 243
Target Start/End: Complemental strand, 52135580 - 52135511
Alignment:
| Q |
174 |
ccattgagggcactttccctttcaaagaataagaaattcaaatgttgtttttctcttcaagttcatctca |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
52135580 |
ccattgagggcactttccctttcaaagaataagaaattcaaattttgtttttctcttcaagttcatctca |
52135511 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 54 - 109
Target Start/End: Complemental strand, 52135700 - 52135645
Alignment:
| Q |
54 |
gaaaaaagcttttctgtgaattcaacatcatcatcaaaatccaagaactatgatcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52135700 |
gaaaaaagcttttctgtgaattcaacatcatcatcaaaatccaagaactatgatcc |
52135645 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University