View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_52 (Length: 270)
Name: NF1319_low_52
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 29 - 255
Target Start/End: Complemental strand, 33161724 - 33161498
Alignment:
| Q |
29 |
aaagcttttacttgcaactattggagtaggtttaacaaaaattgttttccttgtaattgctttgtttttacttgacaaacttggtagaagacgacttttg |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161724 |
aaagcttttacttgcaactattggagtaggtttaacaaaaattgttttccttgtaattgctttgtttttacttgacaaacttggtagaagacgacttttg |
33161625 |
T |
|
| Q |
129 |
caaattagcaccggaggaatgattattggacttacgctattgggccttagcttgaccgtggtggataaatccaacggaaacgttttatgggccttgatcc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33161624 |
caaattagcaccggaggaatgattattggacttacgctattgggccttagcttgaccgtggtggataaatccaacggaaacgttttatgggccttgatcc |
33161525 |
T |
|
| Q |
229 |
ttagcatcgtcgcaacttatgcctatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
33161524 |
ttagcatcgtcgcaacttatgcctatg |
33161498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 33 - 163
Target Start/End: Complemental strand, 31988551 - 31988421
Alignment:
| Q |
33 |
cttttacttgcaactattggagtaggtttaacaaaaattgttttccttgtaattgctttgtttttacttgacaaacttggtagaagacgacttttgcaaa |
132 |
Q |
| |
|
||||| |||||||| ||||| || || |||||||| ||| |||| |||||| ||||||| ||||| |||| ||| ||||||||||| | | || ||| |
|
|
| T |
31988551 |
cttttgcttgcaacaattggtgttggattaacaaagattatttttcttgtacttgctttatttttgattgataaagttggtagaagaaggttattacaag |
31988452 |
T |
|
| Q |
133 |
ttagcaccggaggaatgattattggacttac |
163 |
Q |
| |
|
||||||| | ||||||||||||||||||||| |
|
|
| T |
31988451 |
ttagcactgcaggaatgattattggacttac |
31988421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University