View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_55 (Length: 260)
Name: NF1319_low_55
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_55 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 97; Significance: 9e-48; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 101 - 232
Target Start/End: Complemental strand, 24537349 - 24537213
Alignment:
| Q |
101 |
gaagtagatttaaagcgacaagagttgcggaagtcaaaccaagctggaatagaagagcagattcgttcggtagaggtaaaaagagagaagcttcag---- |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
24537349 |
gaagtagatttaaagcgacaagagttgcggaagtcaaaccaagctggaaaagaagagcagattcatttggtagaagtaaaaagagagaagcttcagacag |
24537250 |
T |
|
| Q |
197 |
-agacaagcaacgggacgagaacgtgccgccagagtt |
232 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |
|
|
| T |
24537249 |
aagacaaacaacgggacgagaacgtgccgccagagtt |
24537213 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 188
Target Start/End: Original strand, 24318109 - 24318196
Alignment:
| Q |
101 |
gaagtagatttaaagcgacaagagttgcggaagtcaaaccaagctggaatagaagagcagattcgttcggtagaggtaaaaagagaga |
188 |
Q |
| |
|
||||||||| ||||||||||||||||| ||| ||||| |||||||||| || ||||| |||| |||||| || ||| ||||||||| |
|
|
| T |
24318109 |
gaagtagatctaaagcgacaagagttgttgaaatcaaaacaagctggaaaggacgagcaaattcattcggtggaagtagaaagagaga |
24318196 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University