View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_66 (Length: 245)
Name: NF1319_low_66
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_66 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 148; Significance: 3e-78; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 89 - 244
Target Start/End: Original strand, 44194416 - 44194571
Alignment:
| Q |
89 |
tatatgcagcagcagcattttttgatgataaatctgccaaggtttttgtttccggtcatcgaggtcttgttggttcggccattgttcgcaagctgactca |
188 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44194416 |
tatatgcagcagcagcattttttgattataaatctgccaaggtttttgtttccggtcatcgaggtcttgttggttcggccattgttcgcaagctgactca |
44194515 |
T |
 |
| Q |
189 |
actcgggttcacaaatctaatcttgagaactcatacggagcttcatctcactcgac |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
44194516 |
actcgggttcacaaatctaatcttgagaactcatacggagcttgatctcactcgac |
44194571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University