View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1319_low_70 (Length: 222)
Name: NF1319_low_70
Description: NF1319
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1319_low_70 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 125; Significance: 2e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 1 - 125
Target Start/End: Original strand, 44489072 - 44489196
Alignment:
| Q |
1 |
aaaaattgttttcttaccaaatgttggggaattaaaagttgtccatccatcaccaacactgtgattgccggtgataattgttcggttgattccatctccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44489072 |
aaaaattgttttcttaccaaatgttggggaattaaaagttgtccatccatcaccaacactgtgattgccggtgataattgttcggttgattccatctccg |
44489171 |
T |
 |
| Q |
101 |
atcatcatcagatacgccttgtttt |
125 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
44489172 |
atcatcatcagatacgccttgtttt |
44489196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University