View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_high_34 (Length: 253)
Name: NF13200_high_34
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_high_34 |
 |  |
|
| [»] chr6 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 72; Significance: 7e-33; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 174 - 253
Target Start/End: Complemental strand, 15135916 - 15135837
Alignment:
| Q |
174 |
tacctttaaaattagagagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt |
253 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15135916 |
tacctttaaaattaatgagttttcatgtcttcttcaagagagaaaatagcaacttgaattaaaaccgttgttttgcattt |
15135837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 17 - 90
Target Start/End: Complemental strand, 15136073 - 15136000
Alignment:
| Q |
17 |
actgataaaaggatcatataagaaaaatattgcatgtgttgtgttcatacgaagattctagagaggaaagagac |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15136073 |
actgataaaaggatcatataagaaaaatattgcatgtgttgtgttcatatgaagattctagagaggaaagagac |
15136000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University