View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_high_36 (Length: 249)
Name: NF13200_high_36
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_high_36 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 231; Significance: 1e-127; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 1 - 239
Target Start/End: Complemental strand, 33710693 - 33710455
Alignment:
| Q |
1 |
cttagactattcaacccaccatttccaccctgagaaatggtaccctccacttctagcatcaacagtatgtggaggaattcttggtttgatgtggcaatgg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33710693 |
cttagactattcaacccaccatttccaccctgagaaatggtaccctccacttctagcatcaacagtatgtggaggaattcttggtttgatgtggcaatgg |
33710594 |
T |
 |
| Q |
101 |
atcattgcaagccacccggaaaaggcgctcagggcagcattttggttgagtccattgttaacttgtgcaatgggaattctgtttgtgttaattggttctg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33710593 |
atcattgcaagccacccggaaaaggcgctcagggcagcattttggttgagtccattgttaacgtgtgcaatgggaattctgtttgtgttaattggttctg |
33710494 |
T |
 |
| Q |
201 |
cattgagtttggtagttggtatagtttctttgatctctg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
33710493 |
cattgagtttggtagttggtatagtttctttgatttctg |
33710455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University