View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_high_37 (Length: 248)
Name: NF13200_high_37
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_high_37 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 21937015 - 21936782
Alignment:
| Q |
1 |
atctcaacaaacatatgactcccccatttcttacgggaaaaatgaatgaattgagtcggtgatagtggcaggctacatattatgatccataatgc-ttca |
99 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
21937015 |
atctcaacaaacatatgaatcccccatttcttacgggaaaaatgaatgaattgagtcggtgatagtggcaggctacatattatgatccataatgccttca |
21936916 |
T |
 |
| Q |
100 |
ttacttgtcatccataaatttaagagacacatatcatccattaatagtgtatacatcatcaatacaattatcaagttttaaagtggcttgacttataagc |
199 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21936915 |
ttgcttgtcatccataaatttaagagacacatatcatccattaatagtgtatacattatcaatacaattatcaagttttaaagtggcttgacttataagc |
21936816 |
T |
 |
| Q |
200 |
tttcaaatcatgtacatttaaagaatgttgtgtgt |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
21936815 |
-ttcaaatcatgtacatttaaagaatgttgtgtgt |
21936782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University