View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_high_39 (Length: 240)
Name: NF13200_high_39
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_high_39 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 10 - 222
Target Start/End: Original strand, 42225999 - 42226210
Alignment:
| Q |
10 |
gaagaatatatataaaattaaaatgaagctagagctagctatacgaaatgaataggttgatcatatgcatgacatgtattgtattgctaatgctggttgg |
109 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42225999 |
gaagaatatatataaa-ttaaaatgaagctagagctagctatacgaaatgaataggttgatcatatgcatgacatgtattgtattgctaatgctggttgg |
42226097 |
T |
 |
| Q |
110 |
ttcatacatctgtgaatatagtgcttcttaaatagtgcaaattctgctacctcatttaaattgtcactctcttagtgatcagatgctgagaccctactca |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42226098 |
ttcatacatctgtgaatatagtgcttcttaaatagtgcaaattctactacctcatttaaattgtcactctcttagtgatcagatgctgagaccctactca |
42226197 |
T |
 |
| Q |
210 |
ccaagcttttaca |
222 |
Q |
| |
|
||||||||||||| |
|
|
| T |
42226198 |
ccaagcttttaca |
42226210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University