View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_low_12 (Length: 475)
Name: NF13200_low_12
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_low_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 231; Significance: 1e-127; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 231; E-Value: 1e-127
Query Start/End: Original strand, 230 - 464
Target Start/End: Complemental strand, 30018677 - 30018443
Alignment:
| Q |
230 |
gaatatcaaaataacttttttaccagttttcaataggtgagatatttcagtaatacctatttcattttgtgttgcttgtaatctactttccaatgtagct |
329 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30018677 |
gaatatcaaaatcacttttttaccagttttcaataggtgagatatttcagtaatacctatttcattttgtgttgcttgtaatctactttccaatgtagct |
30018578 |
T |
|
| Q |
330 |
aagtttgctttggctttttcagcttcttcttgtgcttcaagaagttgagctttagcagtttgagctagtgatttagcttcatcagcttcttgtgctgctg |
429 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30018577 |
aagtttgctttggctttttcagcttcttcttgtgcttcaagaagttgagctttagcagtttgagctagtgatttagcttcatcagcttcttgtgctgctg |
30018478 |
T |
|
| Q |
430 |
cttgaagtttcttaggtaactcagccataatctct |
464 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
30018477 |
cttgaagtttcttaggtaactcagccataatctct |
30018443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 17 - 162
Target Start/End: Complemental strand, 30018886 - 30018741
Alignment:
| Q |
17 |
agaatcaacttcatttttgttgcttcctcctctagctgattcacttctctccaatgctttgattgaatctttagccaatttttcagaaactttagcagct |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30018886 |
agaatcaacttcatttttgttgcttcctcctctagctgattcacttctctccaatgctttgattgaatctttagccaatttttcagaaactttagcagct |
30018787 |
T |
|
| Q |
117 |
cctgttattagagataaagttagtcaagaattagagcccatttgtg |
162 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30018786 |
cctgttattagagataaagttagtcaagaattagagcccatttgtg |
30018741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University