View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_low_28 (Length: 297)
Name: NF13200_low_28
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 28 - 291
Target Start/End: Original strand, 51938015 - 51938287
Alignment:
| Q |
28 |
ggcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgactt---------cttcttctgtag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
51938015 |
ggcgttcctcttcagaaatagaggcaaagggagattgtgttgttgttgatgatctgataggagtgttaggagttgacttgttgttcttcttcttctgtag |
51938114 |
T |
|
| Q |
119 |
agaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctccgaagaatccataactttcttgtgggtttggatcatg |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
51938115 |
agaatgaagttcgtgaattgtttgggctttcaccgatgggctgctgtcgtcgtgacatatctctgaagaatccataactttcttgtgggtttggatcatg |
51938214 |
T |
|
| Q |
219 |
ggtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctcctttg |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51938215 |
ggtagcccacgacgcccaacaacgttgtcaatagttgttccatttctgaaatctgatccattcttctcttttg |
51938287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University