View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13200_low_35 (Length: 267)

Name: NF13200_low_35
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13200_low_35
NF13200_low_35
[»] chr2 (1 HSPs)
chr2 (24-246)||(16905923-16906151)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 24 - 246
Target Start/End: Original strand, 16905923 - 16906151
Alignment:
24 aacataactatcaatattaacttggataatctcattgcactaaatcttgtttcaaaaatagcaagnnnnnnnnntgagtttggcaaagaaaaggattgat 123  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||         ||||||||| ||||||||| ||||||    
16905923 aacataactatcaatatcaacttggataatctcattgcactaaatcttgtttcaaaaatagcaagaaaaaaa--tgagtttggtaaagaaaag-attgat 16906019  T
124 aaaatgactagagatggttagatagaga------cagatagaaaaggggaagatcatgtacttagtgagtgaag---acaaagcaaaaggaattggtgat 214  Q
    ||||||||||||||| || |||||||||      ||||||||||||||||||||||||||||||||||||||||   |||||||||||||||||||||||    
16906020 aaaatgactagagatagtgagatagagatagagacagatagaaaaggggaagatcatgtacttagtgagtgaagaagacaaagcaaaaggaattggtgat 16906119  T
215 gatgatattagtgaaaaaggatataaggggta 246  Q
    |||||||||||||||||| |||||||||||||    
16906120 gatgatattagtgaaaaaagatataaggggta 16906151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University