View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_low_43 (Length: 243)
Name: NF13200_low_43
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_low_43 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 5)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 24 - 91
Target Start/End: Complemental strand, 7499769 - 7499702
Alignment:
| Q |
24 |
gcactatctgttaatacatggctggctttagaatgatgtctcagttttttatgtttcttgatcatgaa |
91 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7499769 |
gcactatctgttaatacatggctggttttagaatgatgtctcagttttttatgtttctagatcatgaa |
7499702 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 90 - 195
Target Start/End: Complemental strand, 7488416 - 7488311
Alignment:
| Q |
90 |
aacatgtctgatagccatagtctcatgattctttataaaacaataccctatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttctttt |
189 |
Q |
| |
|
|||||||||||||| | || ||||||||| ||| || |||||| |||||||||||| |||||||||||| ||| ||||| |||||||||| || |||||| |
|
|
| T |
7488416 |
aacatgtctgatagtcctaatctcatgatccttcatgaaacaaaaccctatgtaactcttctctcatgtcacaccgtaatacacatcaaatccctctttt |
7488317 |
T |
|
| Q |
190 |
ccaaca |
195 |
Q |
| |
|
|||||| |
|
|
| T |
7488316 |
ccaaca |
7488311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 138 - 196
Target Start/End: Original strand, 6943675 - 6943733
Alignment:
| Q |
138 |
tatgtaacccttctctcatgtgacaacgtaacacacatcaaacccttcttttccaacaa |
196 |
Q |
| |
|
||||||||||||||||||||||||||| ||| |||||||||| || |||||||||||| |
|
|
| T |
6943675 |
tatgtaacccttctctcatgtgacaacctaatacacatcaaatcccccttttccaacaa |
6943733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 24 - 71
Target Start/End: Original strand, 8139087 - 8139134
Alignment:
| Q |
24 |
gcactatctgttaatacatggctggctttagaatgatgtctcagtttt |
71 |
Q |
| |
|
|||||||| ||||||||||||||| |||| |||| ||||||||||||| |
|
|
| T |
8139087 |
gcactatcagttaatacatggctgactttggaattatgtctcagtttt |
8139134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 58 - 88
Target Start/End: Original strand, 8139168 - 8139198
Alignment:
| Q |
58 |
gatgtctcagttttttatgtttcttgatcat |
88 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8139168 |
gatgtctcagttttttatgtttcttgatcat |
8139198 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University