View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_low_45 (Length: 239)
Name: NF13200_low_45
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_low_45 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 18 - 146
Target Start/End: Original strand, 29010496 - 29010624
Alignment:
| Q |
18 |
atactcggttctttgcaaaatacgttcacgtccttctttcttgaatgctgctgcatctcttgtctttgttaggtaattgttttcgatgtttttcttttca |
117 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29010496 |
atactcagttctttgcaaaatacgttcacgtcattctttcttgaatgccgctgcatctcttgtctttgttaggtaattgtttttgatgtttttcttttca |
29010595 |
T |
 |
| Q |
118 |
attaccaaaattttctctatttctttgtt |
146 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29010596 |
attaccaaaattttctctatttctttgtt |
29010624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 146 - 239
Target Start/End: Original strand, 29010688 - 29010781
Alignment:
| Q |
146 |
tcaggtcattattatgttaaattaaattatgatctatttgcgcagtaaaaatgcttattcatataagttgctttaagcaagatgataaaatagc |
239 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29010688 |
tcaggtcattattatgttagatcaaattatgatctatttgcgcagtaaaagtgcttattcagataagttgctttaagcaagatgataaaatagc |
29010781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 175 - 239
Target Start/End: Complemental strand, 11494334 - 11494271
Alignment:
| Q |
175 |
tgatctatttgcgcagtaaaaatgcttattcatataagttgctttaagcaagatgataaaatagc |
239 |
Q |
| |
|
||||||||||||| || |||| |||||||||| ||||| || ||| |||||||||| |||||||| |
|
|
| T |
11494334 |
tgatctatttgcgtagcaaaagtgcttattcaaataaggtg-ttttagcaagatgagaaaatagc |
11494271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University