View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13200_low_54 (Length: 203)

Name: NF13200_low_54
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13200_low_54
NF13200_low_54
[»] chr6 (1 HSPs)
chr6 (87-187)||(101330-101430)


Alignment Details
Target: chr6 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 87 - 187
Target Start/End: Complemental strand, 101430 - 101330
Alignment:
87 ggatagcattgtcctcagtctatattatctaatctgacttatgcggccaaacgtaatggctttaacacccttaccatacacatgatcctcgtagtgttca 186  Q
    ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
101430 ggatatcattgtcctcagtctatattatctaatctgtcttatgcggccaaacgtaatggctttaacacccttaccatacaaatgatcctcgtagtgttca 101331  T
187 t 187  Q
    |    
101330 t 101330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University