View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13200_low_54 (Length: 203)
Name: NF13200_low_54
Description: NF13200
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13200_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 89; Significance: 4e-43; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 89; E-Value: 4e-43
Query Start/End: Original strand, 87 - 187
Target Start/End: Complemental strand, 101430 - 101330
Alignment:
| Q |
87 |
ggatagcattgtcctcagtctatattatctaatctgacttatgcggccaaacgtaatggctttaacacccttaccatacacatgatcctcgtagtgttca |
186 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
101430 |
ggatatcattgtcctcagtctatattatctaatctgtcttatgcggccaaacgtaatggctttaacacccttaccatacaaatgatcctcgtagtgttca |
101331 |
T |
 |
| Q |
187 |
t |
187 |
Q |
| |
|
| |
|
|
| T |
101330 |
t |
101330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University