View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13201_low_16 (Length: 270)
Name: NF13201_low_16
Description: NF13201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13201_low_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 164; Significance: 1e-87; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 164; E-Value: 1e-87
Query Start/End: Original strand, 18 - 261
Target Start/End: Complemental strand, 29913615 - 29913357
Alignment:
| Q |
18 |
tggttcggattacataatttggaccacggttat-----ttttgttgttttttgctgggtgcatgagaaacaggcagggtgtgttccagaaaccttataca |
112 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| || ||||||||||||||| |||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
29913615 |
tggttcggattacataatttggaccacgggtatgttttttttttttttttttgctgggtgcgtgagaaacaggcagggtgtgttccagaaaccttacaca |
29913516 |
T |
 |
| Q |
113 |
cacac----------tagttaattcaaaataaaagatatgtgatcaaagttattgcatatgagaccaatccaaacagtcagattatgctttcaatattgg |
202 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
29913515 |
cacacacacacacactagttaattcgaaataaaagatatgtgatcaaaattattgcatatgagaccaagccaaacagtcagattatgctttcaatattgg |
29913416 |
T |
 |
| Q |
203 |
aaatgatttgcaaactactcgtaacagtcaaacaaaagtcagggaaaattattctattt |
261 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
29913415 |
aaatgatttgcaacctactcgtaacagtcaaacaaaagtcaaggaaaattattctattt |
29913357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University