View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13201_low_18 (Length: 232)
Name: NF13201_low_18
Description: NF13201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13201_low_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 193
Target Start/End: Original strand, 55209356 - 55209387
Alignment:
| Q |
162 |
ggttaatgcattagtgttttttaaactaattt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55209356 |
ggttaatgcattagtgttttttaaactaattt |
55209387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University