View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13201_low_18 (Length: 232)

Name: NF13201_low_18
Description: NF13201
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13201_low_18
NF13201_low_18
[»] chr3 (1 HSPs)
chr3 (162-193)||(55209356-55209387)


Alignment Details
Target: chr3 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 162 - 193
Target Start/End: Original strand, 55209356 - 55209387
Alignment:
162 ggttaatgcattagtgttttttaaactaattt 193  Q
    ||||||||||||||||||||||||||||||||    
55209356 ggttaatgcattagtgttttttaaactaattt 55209387  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University