View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13203_high_30 (Length: 243)
Name: NF13203_high_30
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13203_high_30 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Complemental strand, 24877652 - 24877427
Alignment:
| Q |
1 |
ttgaatataggaacaaatgatcacaaggatgaaaaattgttaaaaaatgagattcggacagagtttttcagatgcagtaaaaatgataattaataataat |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24877652 |
ttgaatataggaacaaatgatcaaaaggatgaaaaattgttaaaaaatgagattcggacagagtttttcagatgcagtaaaaatgataatttataataat |
24877553 |
T |
 |
| Q |
101 |
agggaatcttcttgacaatttcatatgtaccaacaattgtttataagtaaaaatattaagcttatcaaaatattggtatgtaatcactcataataatatt |
200 |
Q |
| |
|
| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24877552 |
acggaatcttcttgacaatttcatacgtaccaacaattgtttataagtaaaaatattaagcttatcaaaatattggtatgtaatcactcataataatatt |
24877453 |
T |
 |
| Q |
201 |
gaatattagaaactaataataatatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
24877452 |
gaatattagaaactaataataatatt |
24877427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University