View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13203_low_18 (Length: 349)
Name: NF13203_low_18
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13203_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 72 - 137
Target Start/End: Complemental strand, 54229651 - 54229585
Alignment:
| Q |
72 |
ggaaaggaaagggg-tcatgttatacttctcctttacctttaccacacttccctcattttattagta |
137 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54229651 |
ggaaaggaaagggggtcatgttacacttctcctttacctttaccacacttccctcattttattagta |
54229585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 205 - 250
Target Start/End: Complemental strand, 54229527 - 54229482
Alignment:
| Q |
205 |
catcccatttttctctctgaatcaaaacccaacacaaaccgttatg |
250 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
54229527 |
catcccatttttctctcttaatcaaaacccaacacaaaccgttatg |
54229482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University