View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13203_low_28 (Length: 251)
Name: NF13203_low_28
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13203_low_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 10069190 - 10069415
Alignment:
| Q |
1 |
tatgtgactttatatagttgcaatagaggatgaaaataaaataaagcaaatttttgggattatttaatttctgatggccagcctgcctcaacttattgtt |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
10069190 |
tatgcgactttatatagttgcaatagaggatgaaaataaaataaagcaaatttttgggattatttaatttttgatggccagcctgcctcaacttattgtt |
10069289 |
T |
|
| Q |
101 |
ttcgaggatttcaaggatgatgacaattgtcttgttgatgagagaggaaataagttttggtggtttcattcttcttgtttttgagacgattaactaaacg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
10069290 |
ttcgaggatttcaaggatgatgacaattgtcttgttgatgagagaggaaataagttttggtggtttcattcttcttgtttttgagacgattaactgaacg |
10069389 |
T |
|
| Q |
201 |
caacgcagatactcacatgcctcttt |
226 |
Q |
| |
|
||||||||| |||||||||||||||| |
|
|
| T |
10069390 |
caacgcagaaactcacatgcctcttt |
10069415 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University