View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF13203_low_29 (Length: 247)

Name: NF13203_low_29
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF13203_low_29
NF13203_low_29
[»] chr5 (1 HSPs)
chr5 (19-234)||(36570074-36570289)


Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 36570074 - 36570289
Alignment:
19 aaatatctacccactaatgagaatcatatgaataaaaaatgtcagggaatgaacatccactcataataatattcataagagtgttaattttgatgtcctt 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     
36570074 aaatatctacccactaatgagaatcatatgaataaaaaatgtcagggaatgaacatccactcataataatattcataagagtgttaattttgatgtcctc 36570173  T
119 tgatttgttcaattcatgtggttttcaaattatcgtccttttcacgaggtaggtttgccctaaacttaagatggtggtccatgaaaactactagcccctg 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36570174 tgatttgttcaattcatgtggttttcaaattatcgtccttttcacgaggtaggtttgccctaaacttaagatggtggtccatgaaaactactagcccctg 36570273  T
219 gtctttggcctttgct 234  Q
    | ||||||||||||||    
36570274 gcctttggcctttgct 36570289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University