View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13203_low_29 (Length: 247)
Name: NF13203_low_29
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13203_low_29 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 208; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 19 - 234
Target Start/End: Original strand, 36570074 - 36570289
Alignment:
| Q |
19 |
aaatatctacccactaatgagaatcatatgaataaaaaatgtcagggaatgaacatccactcataataatattcataagagtgttaattttgatgtcctt |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570074 |
aaatatctacccactaatgagaatcatatgaataaaaaatgtcagggaatgaacatccactcataataatattcataagagtgttaattttgatgtcctc |
36570173 |
T |
 |
| Q |
119 |
tgatttgttcaattcatgtggttttcaaattatcgtccttttcacgaggtaggtttgccctaaacttaagatggtggtccatgaaaactactagcccctg |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36570174 |
tgatttgttcaattcatgtggttttcaaattatcgtccttttcacgaggtaggtttgccctaaacttaagatggtggtccatgaaaactactagcccctg |
36570273 |
T |
 |
| Q |
219 |
gtctttggcctttgct |
234 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
36570274 |
gcctttggcctttgct |
36570289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University