View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13203_low_33 (Length: 226)
Name: NF13203_low_33
Description: NF13203
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13203_low_33 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 185; Significance: 1e-100; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 18 - 206
Target Start/End: Original strand, 35044385 - 35044573
Alignment:
| Q |
18 |
atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggtggttggagaacgttttgacggggaaggagaaaagaacaaacaaatacgaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044385 |
atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggtggttggagaacgttttgacggggaaggagaaaagaacaaacaaatacgaa |
35044484 |
T |
|
| Q |
118 |
aagcgtttagggagctcttccatctttgtggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa |
206 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35044485 |
aagcgtttagagagctcttccatctttgtggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa |
35044573 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 206
Target Start/End: Original strand, 35036383 - 35036442
Alignment:
| Q |
147 |
ggttcctttgttatatctgattcgttgccgtttttaagatggttggatttggatggaaaa |
206 |
Q |
| |
|
||||| |||||||||||||| ||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
35036383 |
ggttcatttgttatatctgacatgttgcggttttttagatggttggatttggatggaaaa |
35036442 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 18 - 67
Target Start/End: Original strand, 35036254 - 35036303
Alignment:
| Q |
18 |
atgaagaaatggtttggtgatatagcgataaacgtgatgtttagaacggt |
67 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||| |||| ||||||||| |
|
|
| T |
35036254 |
atgaaaaaatggtttggtgatatagcgatgaacgttatgtgtagaacggt |
35036303 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University