View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13204_high_14 (Length: 249)
Name: NF13204_high_14
Description: NF13204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13204_high_14 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 18 - 234
Target Start/End: Complemental strand, 12608720 - 12608512
Alignment:
| Q |
18 |
gtgtgaaaccacaaaccattcatcatctgctttatcagtaacctctggctgagacccattaaccagcttgttcgcggaattcatgtcggattcggatttt |
117 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||| ||||||||||||||| ||||||||| ||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
12608720 |
gtgtgaaaccacaaaccatccatcatctgctttatcagcaacctctggctgagatccattaaccggcttgttcgtggaattcatgttggattcggatttt |
12608621 |
T |
 |
| Q |
118 |
gaattgtccacatccatgttgtcagaattattatctttgtcgccagaaccactatcttcgtcgtcagaatcattatcttcatcgtctccatcagcattca |
217 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
12608620 |
gaattgtccacatc--------cagaattattatctttgttgccagaaccactatcttcgtcgtcagaatcactatcatcatcgtctccatcagcattca |
12608529 |
T |
 |
| Q |
218 |
caacctagcataacata |
234 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
12608528 |
caacctagcataacata |
12608512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University