View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13204_low_11 (Length: 344)
Name: NF13204_low_11
Description: NF13204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13204_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 1 - 330
Target Start/End: Complemental strand, 7301535 - 7301206
Alignment:
| Q |
1 |
caggcgaaaatggcgcattcaagagattcattcacaaaagaaccggtttagaaccgaaacaaaccgggttcaaatcagagcttcatcaaccaaacctgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7301535 |
caggcgaaaatggcgcattcaagagattcattcacaaaagaaccggtttagaaccgaaacaaaccggtttcaaatcagagcttcatcaaccaaacctgat |
7301436 |
T |
|
| Q |
101 |
ggagaagctgaaaacaatggacaatggtaggaatcgtattcggttggatggattgatcatcaaaacgccggcggagaaaccggcgatgccgaaggaggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7301435 |
ggagaagctgaaaacaatggacaatggtaggaatcgtattcggttggatggattgatcatcaaaacgccggcggagaaaccggcgatgccgaaggaggat |
7301336 |
T |
|
| Q |
201 |
ggtgttagcgtcagtgatgtgaagaaattgttgaaggtggcgcaattagagatggtgaaatcaaggttgagagaatcatcaaagagttgtgtaacggttt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7301335 |
ggtgttagcgtcagtgatgtgaagaaattgttgaaggtggcgcaattagagatggtgaaatcaaggctgagagaatcatcaaagagttgtgtaacggttt |
7301236 |
T |
|
| Q |
301 |
cggagttgattcggatttgttctgaatatt |
330 |
Q |
| |
|
||||||||||| |||||||||||||||||| |
|
|
| T |
7301235 |
cggagttgattaggatttgttctgaatatt |
7301206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University