View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13204_low_13 (Length: 279)
Name: NF13204_low_13
Description: NF13204
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13204_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 84; Significance: 6e-40; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 84; E-Value: 6e-40
Query Start/End: Original strand, 7 - 90
Target Start/End: Original strand, 23452309 - 23452392
Alignment:
| Q |
7 |
gagcagagacattttaggagattgatgaatggctacactagacctgagaaagaacttaaatgatttccaccctcttctgaaaac |
90 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23452309 |
gagcagagacattttaggagattgatgaatggctacactagacctgagaaagaacttaaatgatttccaccctcttctgaaaac |
23452392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 91 - 219
Target Start/End: Complemental strand, 29623916 - 29623784
Alignment:
| Q |
91 |
atttctttcataaagatgattttatcgtttaaatataatatacatcttatctgcttatcaaa----nnnnnnnnnnnnnaacaaacatatgaaaaaacaa |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
29623916 |
atttctttcataaagatgattttatcgtttaaatataatatacatcttatctgcttatcaaatatgtgtgtgtgtgtgtaacaaacatatgaaaagacaa |
29623817 |
T |
 |
| Q |
187 |
aataatgctataccaaacacttgatatgataag |
219 |
Q |
| |
|
||||||||||| ||||||||||||||||||||| |
|
|
| T |
29623816 |
aataatgctatcccaaacacttgatatgataag |
29623784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University