View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13205_high_6 (Length: 369)
Name: NF13205_high_6
Description: NF13205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13205_high_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 253; Significance: 1e-140; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 253; E-Value: 1e-140
Query Start/End: Original strand, 17 - 273
Target Start/End: Original strand, 40005966 - 40006222
Alignment:
| Q |
17 |
aagatttggataaaacctgagaggtctgaagcggcgacgagacgagcatcgttacggaaagagacggaggaaacagtgtcggagaaggaggagatggtgg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40005966 |
aagatttggataaaacctgagaggtctgaagcggcgacgagacgagcatcgttacggaaagagacggaggaaacagtgtcggagaaggaggagatggtgg |
40006065 |
T |
 |
| Q |
117 |
cggtttgggaaagagtttgagagctgaagatggagagagaggctgaattagcggcgacgaaggaatagggtggatttggggagaaggtgatggaagggat |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006066 |
cggtttgggaaagagtttgagagctgaagatggagagagaggctgaattagcggcggcgaaggaatagggtggatttggggagaaggtgatggaagggat |
40006165 |
T |
 |
| Q |
217 |
agagaattgtttagggatttgttgggttttgaaggaagaccagtatttggattcaga |
273 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40006166 |
agagaattgtttagggatttgttgggttttgaaggaagaccagtatttggattcaga |
40006222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 120 - 156
Target Start/End: Original strand, 27851892 - 27851928
Alignment:
| Q |
120 |
tttgggaaagagtttgagagctgaagatggagagaga |
156 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
27851892 |
tttgggaaagggtttgagagctgaagatggagagaga |
27851928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University