View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13205_low_7 (Length: 335)
Name: NF13205_low_7
Description: NF13205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13205_low_7 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 5e-93; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 5e-93
Query Start/End: Original strand, 1 - 205
Target Start/End: Complemental strand, 14309429 - 14309225
Alignment:
| Q |
1 |
ttggtggagtatacgtgggattcacattgttggagtttctttcgatgcaattctttaacttaataaaatgattttgagatctcctaatcccttgtttggg |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14309429 |
ttggtggagtatacatgggattcacattgttggagtttctttggatgcaattctttaacttaataaaatgattttgagatctcctaatcccttgtttggg |
14309330 |
T |
 |
| Q |
101 |
aatggagatcacaagaaaagggaattgaattggaaatgtagaatgaagagacttaattacaaattatcaaatattataatctttagttcatacaaattat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||| |
|
|
| T |
14309329 |
aatggagatcacaagaaaagggaattgaattggaaatgtagaatgaagagacttaattacaaattatcaaatatcgtaattcgtagttcatataaattat |
14309230 |
T |
 |
| Q |
201 |
gataa |
205 |
Q |
| |
|
||||| |
|
|
| T |
14309229 |
gataa |
14309225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 229 - 335
Target Start/End: Complemental strand, 14309043 - 14308945
Alignment:
| Q |
229 |
ataagactttgcactattgaaaatgtgaggtagagatcatatttaatgaacaaagtaagtaaacaaataagtttgattgactaagaaagttaaatatcca |
328 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
14309043 |
ataagactttgcactatcgaaaatgtgaggtagagatcatatttaatgaacaaagtaagtaaacaaataagtttg--------agaaagttaaatatcca |
14308952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University