View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13205_low_8 (Length: 245)
Name: NF13205_low_8
Description: NF13205
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13205_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 226
Target Start/End: Original strand, 31699985 - 31700210
Alignment:
| Q |
1 |
tagcagaagacagactgcagaagggccaacgccggatggctgccaccacatgtttgtggatgcaggatgttttcctaatgggacaacaggatggggactg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31699985 |
tagcagaagacagactgcagaagggccaacgccggatggctgccaccacatgtttgtggatgcaggatgttttcctaatgggacaacaggatggggactg |
31700084 |
T |
 |
| Q |
101 |
attttgaagaacaatgaaggaactgttgttcacagtgaatgcaagttggatactgtggaggtggatccctgtttggctgaagcacttggggtgagatggg |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
31700085 |
attttgaagaacaatgaaggaaccgttgttcacagtgaatgcaagttggatactgtggaggtggatccttgtttggctgaagcacttggggtgagatggg |
31700184 |
T |
 |
| Q |
201 |
ctttaagtacaggtgttagcttagga |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
31700185 |
ctttaagtacaggtgttagcttagga |
31700210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University