View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF13206_high_16 (Length: 323)
Name: NF13206_high_16
Description: NF13206
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF13206_high_16 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 73 - 305
Target Start/End: Complemental strand, 7679574 - 7679342
Alignment:
| Q |
73 |
ctgtagctaagtatctcaaacttcagcgaaagagcttcagatgaaggtaatttttgttgctttctgttatggactatctttatgtaccaatgttaaaaca |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
7679574 |
ctgtagctaagtatctcaaactttagcgaaagagcttcagatgaaggtaatttttgttgctttatgttatggactatctttatgtaccaatgttaaaaca |
7679475 |
T |
|
| Q |
173 |
tttttggggcaattaatttattttgaaattgtaaagatgcaattaaagggtttatgcaattaatttattttttgggggagtcaagttcttggcatttaga |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
7679474 |
tttttggggcaattaatttattttgaaattgtaaagatgcaattaaagggtttatgcaattaatttattttttggggcagtcaagttcttggcaattagg |
7679375 |
T |
|
| Q |
273 |
agtggcggatagcgatgtggacaagtatgatta |
305 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |
|
|
| T |
7679374 |
agtggcggatagcgatgtggacgagtatgatta |
7679342 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University